Dissertation
Dissertation > Medicine, health > Oncology > Genitourinary tumors > Breast tumor

Detection of Circulating Tumor Cells in Breast Cancer Patients by CK19 mRNA

Author XuWenSheng
Tutor WangYaJie
School Second Military Medical University
Course Oncology
Keywords Breast Cancer CK19 mRNA RT-PCR Circulating tumor cells
CLC R737.9
Type Master's thesis
Year 2004
Downloads 51
Quotes 0
Download Dissertation

The main origin of breast cancer in the breast ductal epithelium, is the most common malignancy in women worldwide each year, about 1.2 million women of breast cancer, 500,000 women die from breast cancer. And the incidence is increasing every year. One way of surgery remains the primary treatment of non-metastatic breast cancer. Since the last century fifties Fisher proposed that breast cancer is a systemic disease, systemic medical therapy in the treatment of breast cancer began to be widely appreciated. A large number of clinical trial results showed that adjuvant chemotherapy in breast cancer mortality decreased by about 25%, adjuvant endocrine therapy enables the mortality rate dropped from 30% to 40%. These findings further laid the important role of adjuvant therapy in the treatment of breast cancer, breast cancer treatment focus from the past to surgery alone with systemic therapy, including comprehensive treatment of the development. Prone to breast cancer distant metastasis, even if it is less than 2cm lump, higher incidence of distant metastasis. Check means (such as CT, MRI, ultrasound, bone scan, etc.) is generally only detect metastases than 1cm early is difficult to understand the patient whether the presence of distant metastases, making it difficult to implement targeted predictable treatment programs. In recent years, there has been immunocytochemistry and RT-PCR method to detect circulating tumor cells in the bone marrow and peripheral blood of patients with various types of cancer, the scientific stage breast cancer patients. Early systemic treatment of patients with micrometastases already exist, local surgical treatment, induction chemotherapy-induced endocrine therapy. Eradication of occult lesions is the key to successful treatment. Under normal circumstances, the blood is not the presence of epithelial cells. If detection in peripheral epithelial antigens such as the CK Series, indicating the presence of cells of epithelial origin, and most likely to be cancerous. At home and abroad in recent years, there are many articles on the RT-PCR detection of circulating tumor cells, was measured to this dispute, because: vein puncture skin cells contamination can lead to false positive normal blood, peripheral blood leukocytes have illegally transcription. The subject to eliminate false positives and illegal transcription as the starting point, the first to establish the the mature RT-PCR reaction system and conditions. And peripheral blood CK19 positive rate, by observing the stages of breast cancer and to explore the relationship between circulating tumor cells and clinical stage. In order to provide a valuable reference indicators for clinical staging and chemotherapy. Method: 1, the outer peripheral venous blood taken prior to use of the blood collection tube of the mixture was allowed to stand at room temperature, marked good patient number. Standard puncture technique, vertical take the tube, below the patient's arm. To prevent epidermal cell contamination can not be the first tube of blood, the waste pipe connected to the start and the last of the blood, and only the middle 1.5ml blood samples for analysis. Make sure the shift tube is no longer bleeding. Gently shake after blood collection blood collection. Blood samples were collected and stored at 4 ℃ refrigerator, not more than five days. LT; WP = 6 GT;, blood sample, RNA was prepared 1.5ml erythrocyte lysate, and mix, 1400rpm centrifuged for 5 minutes, discard the supernatant liquid. Precipitation plus 1ml leukocyte lysate, whip. Plus chloroform, and mix the supernatant. Isopropanol, mix, add an equal volume (0.5ml) on the adsorption column, the low-temperature high-speed centrifugation. Plus 0.5ml RP liquid into the column, the low temperature and high speed centrifugation, the traveling column into a new collection tube, adding 0.5ml W3 liquid, low temperature and high speed centrifugation of 90 seconds. Traveling column into a new 1.5ml microcentrifuge tube, the center of the column membrane plus 50μl of pure water, the low temperature and high speed centrifugation, the centrifuge tube containing the RNA was stored at -70 ° C. Formaldehyde agarose gel electrophoresis, spectrophotometer the total RNA A260 and A260/A280. 3, primer design and synthesis according to KRT19 (CK19) mRNA sequence, use the \The primers were synthesized by Shen Yousheng Biotechnology Limited. 4, one-step RT-PCR do first positive control, one-step RT-PCR experiments cases. Then use the extracted RNA samples to do a one-step RT-PCR, GAPDH was used as an internal control. The reaction system was 50μl, constituted as follows: 5μl RNA in PCR buffer, 10 μl MgCl (25m M), 5μl mM dNTP mixture (10 mM), 1μlRNA inhibitors (40u/μl), 1 μl of the AMV reverse transcriptase XL (5U/ul ), 1 μl AMV-Optimized Taq DNA polymerase (5 u / μl), 1 μl Raw specific primer was (20 μm), 1 μl of Preparation specific primers was (20 μm), the 10μl extracted RNA, 15μl RNA enzyme-free water. Reaction conditions: 50 ° C for 30 minutes under the reverse transcription, 94 ° C for 2 minutes inactivated reverse transcriptase at 94 ° C for 30 seconds denaturation at 60 ° C for 30 seconds, annealing at 72 ° C for 1.5 minutes extension, do 25 to 40 cycle. 5μl RT-PCR reaction solution was a 1.5% agarose gel electrophoresis and bromine has ingot staining. 5, sequencing the RT-PCR amplification product sent sequencing. 6, expand the sample to detect all study subjects were divided into three groups. Group 1 blood samples from 77 patients with breast cancer I / II breast cancer patients, group 2 blood samples from 77 cases of stage Ⅲ / Ⅳ breast cancer patients, blood samples from 40 cases of general outpatient (non-cancer) do control group. 7: Statistical analysis using the chi-square test to judge the relationship between breast cancer staging and CK19 mRNA expression. LT; 0.05 defined as significant P. Results: 1, mixed with the of 0.25ml ACD anticoagulant 1.5ml blood taken smoothly, no clotting or hemolysis. 2, a small amount of blood total RNA rapid extraction of total RNA extraction kit 1% formaldehyde denaturing agarose gel electrophoresis and stained with ethidium bromide under UV light can be seen clearly 18S rRNA, 28S rRNA band. Measured A260/A280 between 1.9 and 2.1, indicating the high purity of RNA. The the A260 OD values ??between 0.2 and 0.3, the corresponding RNA concentration was 320 ~ 480μg/ml, requirements in accordance with RT-PCR. lt; WP = 7 gt; 3, the design of primer pairs for the Primer A (bp453): 5'-TGTCCTGCAGATCGACAATG-3 ', Primer B (bp766C): 5'-ATTGGCTTCGCATGTCACTC-3'. Confirmed compared to the nucleotide databases of CK19 specific primers, calculate the length of the product was amplified as a 314bp. Primer synthesis by the Shanghai Shen Yousheng biotechnology limited liability company. 4, the annealing temperature was 60 ℃, the cycle number 30, the metastatic breast cancer patient samples on 1.5% agarose gel electrophoresis showed clear 314bp PCR product band, while the normal blood sample strip. 5, RT-PCR products were confirmed by sequencing a specific fragment of CK19. Sequence: atccaggacctgcgggacaagattcttggtgccaccattgagaactccaggattgtcctgcagatcgacaatgcccgtctggctgcagatgacttccgaaccaagtttgagacggaacaggctctgcgcatgagcgtggaggccgacatcaacggcctgcgcagggtgctggatgagctgaccctggccaggaccgacctggagatgcagatcgaaggcctgaaggaagagctggcctacctgaagaagaaccatgaggaggaaatcagtacgctgaggggccaagtg

Related Dissertations
More Dissertations